Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Neuroinflammation in the post-ischemic human and murine brain. a – c Immunohistochemical staining of CD45 + ( a ), Iba1 + ( b ), and CD68 + ( c ) microglia/macrophages in human post-mortem ischemic brain tissue. d – i Immunohistochemical staining of TNF + ( d ), TNFR1 + ( e ), TNFR2 + ( f ), IL-1β + ( g ), IL-1α + ( h ), and IL-1Ra + ( i ) cells in human post-mortem ischemic brain tissue. ( j, k ) Immunofluorescence double staining showing co-localization of IL-6 to NeuN + neurons ( j ), but absence of IL-6 to CD11b + microglia/macrophages ( k ) in the murine brain after pMCAO. l Immunofluorescence double staining showing co-localization of IL-6R to NeuN + neurons in the murine brain after pMCAO. Unpublished images of CD45, Iba1, CD68, TNF, TNFR1, TNFR2, and IL-1Ra stained tissue sections were acquired from human post-mortem ischemic brain tissue processed as previously described [ , ] using already published protocols, except for IL-1β and IL-1α. Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad). Unpublished images of IL-6 and IL-6R co-localized cells were acquired from parallel tissue sections from mice subjected to pMCAO as described in . In images a – i , Toluidine blue was used as a counterstain and in j – l , DAPI was used as a nuclear marker. Scale bars: a , i = 40 μm, j = 20 μm, and k , l = 20 μm. IL interleukin, IL-6R interleukin-6 receptor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor. The use of human brains was approved by the Danish Biomedical Research Ethical committee for the Region of Southern Denmark (permission number S-20080042) as stated in the original references

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Immunohistochemical staining, Staining, Immunofluorescence, Double Staining, Marker

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Studies on anti-cytokine treatments in experimental and human stroke

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Injection, Functional Assay, Recombinant, Plasmid Preparation, Clinical Proteomics, Infection

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Mechanistic profile of cytokine and cytokine receptor agonists/antagonists for use in experimental stroke

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Bioprocessing, Dominant Negative Mutation, Recombinant

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Temporal profile of cytokine and cytokine receptor upregulation in the acute phase after pMCAO. a Graphical presentation of the temporal profile of TNF, LTα, TNFR1, and TNFR2 mRNAs in the same ischemic hemispheres from mice subjected to pMCAO. b Graphical presentation of the temporal profile of IL-1β, IL-1α, IL-1Ra, IL-1R1, and IL-1R2 mRNAs after pMCAO. c Graphical presentation of the temporal profile of IL-6, IL-6R, and gp130 mRNAs after pMCAO. Data are presented as relative increases in mRNA levels compared with unmanipulated controls. TNF, TNFR1 and TNFR2 mRNA data have been obtained from [ , ], whereas LTα mRNA data are unpublished data performed on the same experimental mice and conditions as . The sequence of the LTα TaqMan probe was AGGAGGGAGTTGTTGCTCAAAGAGAAGCCA, for the LTα sense primer it was CTGCTGCTCACCTTGTTGGG, and for the LTα antisense primer it was TAGAGGCCACTGGTGGGGAT. IL-1α, IL-1β, IL-1Ra, IL-1R1, and IL-1R2 mRNA data have been obtained from . IL-6, IL-6R, and gp130 mRNA data have been obtained from . Note the logarithmic Y axis. gp130 glycoprotein 130, IL interleukin, IL-6R interleukin-6 receptor, LT α lymphotoxin-alpha, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Sequencing

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Schematics presenting mechanisms of actions of approved and selected experimental cytokine and cytokine receptor agonists and antagonists. a – c TNF ( a ), IL-1 ( b ), and IL-6 ( c ) signaling via their receptors and mechanisms of actions of approved and selected novel inhibitors. Figures are modified using Protein Lounge Pathway Database ( www.proteinlounge.com ). Ab antibody, gp130 glycoprotein 130, icIL-1Ra intracellular interleukin-1 receptor antagonist, IL interleukin, IL-1Ra interleukin-1 receptor antagonist, IL-1R1 interleukin-1 receptor type 1, IL-1R2 interleukin-1 receptor type 2, IL-1RAcP IL-1 receptor accessory protein, sIL-1RAcP soluble IL-1 receptor accessory protein, IL-6R interleukin-6 receptor, sgp130 soluble glycoprotein 130, solIL-6R soluble interleukin-6 receptor, solTNF soluble tumor necrosis factor, tmTNF transmembrane tumor necrosis factor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Modification

Journal: Science Advances

Article Title: Injectable hydrogel with MSNs/microRNA-21-5p delivery enables both immunomodification and enhanced angiogenesis for myocardial infarction therapy in pigs

doi: 10.1126/sciadv.abd6740

Figure Lengend Snippet: ( A ) In vitro uptake of the MSN/miR-21-5p complex by adherent endothelial cells (ECs) and macrophages (MCs). ( B ) In vitro transfection efficiency of miR-21-5p was determined by quantifying the miRNA level using real-time quantitative PCR. ( C ) Representative flow cytometry analysis of CD31 levels in ECs and F4/80 levels in MCs. ( D ) In vitro uptake of the MSN/miR-21-5p complex by ECs and MCs was determined by quantifying the double-positive cells (CD31 or F4/80 and Cy3) using flow cytometric analysis. The protein expression levels of VEGFA and PDGF-BB in endothelial cells ( E ) and tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and IL-6 in macrophages ( F ) were determined by the real-time quantitative PCR and Western blot analysis. ( G ) The endothelial cells that formed three-dimensional (3D) capillary-like tubular structures were evaluated at indicated times (8 and 16 hours). ( H ) Schematic diagram of the experimental setup. TUNEL, terminal deoxynucleotidyl transferase–mediated deoxyuridine triphosphate nick end labeling. ( I ) Apoptosis-positive cardiomyocytes from these treatment groups were further quantified. ( J ) Protein levels of secreted proangiogenic factors were determined by enzyme-linked immunosorbent assay (ELISA) analysis of cell supernatants from the MSN/miRNA-treated ECs (scale bars, 50 μm). * P < 0.05 and *** P < 0.01. All experiments were carried out in triplicate. n = 5 per group. The data are shown as means ± SD. Photo credit: Yan Li, Shanghai Ninth People’s Hospital, College of Stomatology, Shanghai Jiao Tong University School of Medicine, Shanghai 200011, China.

Article Snippet: The membranes were blocked with 5% bovine serum albumin and incubated with specific primary antibodies against the following: TNF-α (AF-410-NA, R&D, USA), IL-1β (Novus, AF-401-NA), IL-6 (bs-0782R, Bioss, USA), VEGFA (DF7470, Affinity, USA), PDGF-BB (bs-1316R, Bioss), TLR1 (NB100-56563, Novus), TLR2 (Abcam, ab209217), TLR3 (NBP2-24875, Novus), TLR8 (NBP2-24917, Novus), NFκB (CST8242s, Cell Signaling Technology, USA), p-NFκB (CST3033s), SPRY1 (Abcam, ab111523), P-ERK1/2 (AF1018, R&D), ERK1/2 (AF1576, R&D), P-AKT (AF887, R&D), AKT (MAB2055, R&D), P-FAK (MAB4528, R&D), FAK (AF4467, R&D), P-P38 (CST4511), P38 (CST8690), and GAPDH (ab181602) at a ratio of 1:1000 overnight.

Techniques: In Vitro, Transfection, Real-time Polymerase Chain Reaction, Flow Cytometry, Expressing, Western Blot, TUNEL Assay, End Labeling, Enzyme-linked Immunosorbent Assay

Journal: Science Advances

Article Title: Injectable hydrogel with MSNs/microRNA-21-5p delivery enables both immunomodification and enhanced angiogenesis for myocardial infarction therapy in pigs

doi: 10.1126/sciadv.abd6740

Figure Lengend Snippet: ( A ) A heatmap of selected proteins representing major altered signaling pathways in three datasets of macrophages treated with MSNs, MSN/miR-NC, or MSN/miR-21-5p complexes. Macrophages with no treatment were used as a negative control. The color bar indicates normalized z score intensity-based absolute quantification. ( B ) KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway analysis of both up- and down-regulated pathways in macrophages after MSN treatment. The most significant pathways in the phosphoproteome are plotted on the x axis as the −log 10 of the P value, compared with the proteome. ( C ) KEGG pathway map of Toll-like signaling pathway. Proteins shown with red backgrounds are down-regulated in macrophages after MSN complex treatments when compared with macrophages with no treatment, as determined by pathway analysis. ( D ) Real-time quantitative PCR and Western blot analysis of TLR1, TLR2, TLR3, TLR8, P-NFκB, TNF-α, IL-1β, and IL-6 protein content alteration in macrophages after treatment with MSNs, MSN/miR-NC, or MSN/miR-21-5p complexes. ( E ) Real-time quantitative PCR and Western blot analysis of P-NFκB, TNF-α, IL-1β, and IL-6 protein content alteration in MSN/miR-21-5p complex–treated macrophages that overexpress TLR2 with the TLR2 overexpression vector. *** P < 0.01. n = 3 per group. The data are shown as means ± SD. Photo credit: Yan Li, Shanghai Ninth People’s Hospital, College of Stomatology, Shanghai Jiao Tong University School of Medicine, Shanghai 200011, China.

Article Snippet: The membranes were blocked with 5% bovine serum albumin and incubated with specific primary antibodies against the following: TNF-α (AF-410-NA, R&D, USA), IL-1β (Novus, AF-401-NA), IL-6 (bs-0782R, Bioss, USA), VEGFA (DF7470, Affinity, USA), PDGF-BB (bs-1316R, Bioss), TLR1 (NB100-56563, Novus), TLR2 (Abcam, ab209217), TLR3 (NBP2-24875, Novus), TLR8 (NBP2-24917, Novus), NFκB (CST8242s, Cell Signaling Technology, USA), p-NFκB (CST3033s), SPRY1 (Abcam, ab111523), P-ERK1/2 (AF1018, R&D), ERK1/2 (AF1576, R&D), P-AKT (AF887, R&D), AKT (MAB2055, R&D), P-FAK (MAB4528, R&D), FAK (AF4467, R&D), P-P38 (CST4511), P38 (CST8690), and GAPDH (ab181602) at a ratio of 1:1000 overnight.

Techniques: Negative Control, Real-time Polymerase Chain Reaction, Western Blot, Over Expression, Plasmid Preparation

Journal: Science Advances

Article Title: Injectable hydrogel with MSNs/microRNA-21-5p delivery enables both immunomodification and enhanced angiogenesis for myocardial infarction therapy in pigs

doi: 10.1126/sciadv.abd6740

Figure Lengend Snippet: Histological sections of the infarct zone (day 1 after MI) were immunolabeled with antibodies targeting TNF-α (A), IL-6 (B), or IL-1β (C) and colabeled with the macrophage marker F4/80 (green). Cell nuclei were counterstained with DAPI (blue). ( D ) The percentages of cells double positive for F4/80 and TNF-α, IL-1β, or IL-6 (TNF-α–, IL-1β–, or IL-6–expressing macrophages, respectively) were quantified. Quantification was performed in at least eight high-resolution images acquired from at least eight different regions of each heart. Scale bars, 100 μm. *** P < 0.01. n = 3 per group. The data are shown as the means ± SD. Photo credit: Yan Li, Shanghai Ninth People’s Hospital, College of Stomatology, Shanghai Jiao Tong University School of Medicine, Shanghai 200011, China.

Article Snippet: The membranes were blocked with 5% bovine serum albumin and incubated with specific primary antibodies against the following: TNF-α (AF-410-NA, R&D, USA), IL-1β (Novus, AF-401-NA), IL-6 (bs-0782R, Bioss, USA), VEGFA (DF7470, Affinity, USA), PDGF-BB (bs-1316R, Bioss), TLR1 (NB100-56563, Novus), TLR2 (Abcam, ab209217), TLR3 (NBP2-24875, Novus), TLR8 (NBP2-24917, Novus), NFκB (CST8242s, Cell Signaling Technology, USA), p-NFκB (CST3033s), SPRY1 (Abcam, ab111523), P-ERK1/2 (AF1018, R&D), ERK1/2 (AF1576, R&D), P-AKT (AF887, R&D), AKT (MAB2055, R&D), P-FAK (MAB4528, R&D), FAK (AF4467, R&D), P-P38 (CST4511), P38 (CST8690), and GAPDH (ab181602) at a ratio of 1:1000 overnight.

Techniques: Immunolabeling, Marker, Expressing

Journal: Journal of neuroinflammation

Article Title: Responses of perivascular macrophages to circulating lipopolysaccharides in the subfornical organ with special reference to endotoxin tolerance.

doi: 10.1186/s12974-019-1431-6

Figure Lengend Snippet: Fig. 3 Effect of macrophage deprivation on LPS-induced IL-1β immunoreactivity in the SFO. Cryosections were immunostained with antibodies against the outer basement membrane marker laminin-111, the myeloid lineage cell marker Iba1, and IL-1β. a Localization of peripherally injected control liposomes in the SFO. DiI-labeled control liposomes were found in the SFO perivascular space and co-localized with Iba1 immunoreactivity. b IL-1β immunoreactivity was found in the perivascular space (arrows) of the SFO following LPS injection in liposome (−) mice and control empty liposome-injected mice. A decreased number of Iba1+ cells and attenuated IL-1β immunoreactivity were seen in the perivascular space of the SFO following LPS injection in clodronate liposome-injected mice. c Quantitative analysis revealing the effects of clodronate liposome injection on the number of Iba1+ cells in the SFO of adult mice. N = 4. *P < 0.05, determined by one-way ANOVA with Scheffé’s post hoc test. d Quantitative analysis revealing the effects of clodronate liposome injection on the number of IL-1β+ Iba1+ cells in the perivascular space of the adult mice SFO. N = 4. **P < 0.01, determined by one-way ANOVA with Scheffé’s post hoc test. clod, clodronate liposomes; cont, control empty liposomes; Laminin, laminin-111; p, parenchymal area; v, vasculature. Scale bars are 10 μm

Article Snippet: In order to determine IL-1β antibody specificity, the primary antibody was preincubated with 4 μg/ml of the mouse IL-1β recombinant protein (401-ML, R&D Systems) for 24 h at 4 °C.

Techniques: Membrane, Marker, Injection, Control, Liposomes, Labeling

Journal: Journal of neuroinflammation

Article Title: Responses of perivascular macrophages to circulating lipopolysaccharides in the subfornical organ with special reference to endotoxin tolerance.

doi: 10.1186/s12974-019-1431-6

Figure Lengend Snippet: Fig. 5 Effect of the second LPS injection on IL-1β immunoreactivity in the SFO. Cryosections were immunostained with antibodies against LPS, the myeloid lineage cell marker Iba1, and the outer basement membrane marker laminin-111. a Immunoreactivity of LPS was found in the SFO perivascular space 1 h after the second dose of LPS injection of vehicle- and LPS-pre-injected mice. b Immunohistochemistry showed that IL-1β expression was predominantly observed in the Iba1+ perivascular macrophages inside (arrows) or spanning (arrowheads) the laminin-111+ outer basement membrane following the second LPS injection 4 days after the first vehicle injection (vehicle-4 days-LPS) and 2 days after the first LPS injection (LPS-2 days-LPS). In contrast, following the second LPS injection 4 days after the first LPS injection (LPS-4 days-LPS), IL-1β immunoreactivity was rarely found in the Iba1+ perivascular macrophages of mice injected with LPS for the first dose. c Quantitative analysis revealing the effects of second LPS injection 4 days after the first vehicle or LPS injection on the number of IL-1β+ Iba1+ cells in the SFO of adult mice. N = 4. *P < 0.05, determined by Student’s t test. Laminin, laminin-111; N.D., not detected; p, parenchymal area; v, vasculature. Scale bars are 10 μm

Article Snippet: In order to determine IL-1β antibody specificity, the primary antibody was preincubated with 4 μg/ml of the mouse IL-1β recombinant protein (401-ML, R&D Systems) for 24 h at 4 °C.

Techniques: Injection, Marker, Membrane, Immunohistochemistry, Expressing

Journal: Journal of neuroinflammation

Article Title: Responses of perivascular macrophages to circulating lipopolysaccharides in the subfornical organ with special reference to endotoxin tolerance.

doi: 10.1186/s12974-019-1431-6

Figure Lengend Snippet: Fig. 6 A schematic diagram. SFO Iba1+ perivascular macrophages expressed IL-1β 1 h after the first dose of peripheral LPS injection (first LPS challenge). Four days after the first injection, mice became endotoxin-tolerant. Bone marrow-derived perivascular macrophages accumulated in the SFO and did not express IL-1β after the second dose of LPS (tolerance established)

Article Snippet: In order to determine IL-1β antibody specificity, the primary antibody was preincubated with 4 μg/ml of the mouse IL-1β recombinant protein (401-ML, R&D Systems) for 24 h at 4 °C.

Techniques: Injection, Derivative Assay